HDL Subclass Distribution Shifts with Increasing Central Adiposity by Nicholas J. Woudberg, Sandrine Lecour, Julia H. Goedecke

“…A percentage decrease in large HDL subclasses was associated with a percentage increase in central fat mass (visceral adipose tissue (VAT) area, p<0.05) and a percentage decrease in peripheral fat mass (leg fat mass). These preliminary findings suggest that a relative redistribution of body fat from the periphery to the abdominal region were associated with a decrease HDL subclass size in black South African women and provide a novel link between body fat distribution and lipidology in this population.…”
Get full text

Comparison of Chest-to-Back Skin-to-Skin Contact and Chest-to-Chest Skin-to-Skin Contact on the Risk of Oxygen Desaturation and Change in Heart Rate in Low Birth Weight and/or Prem... by Sisay Gere, Yemane Berhane, Alemayehu Worku

“…We used a parallel-group randomized controlled clinical trial. Peripheral arterial blood oxygen saturation (SpO2) and heart rate (HR) were measured using an OxiMaxN-600X Pulse Oximeter. …”
Get full text

The Role of Clopidogrel in 2020: A Reappraisal by Giuseppe Patti, Giuseppe Micieli, Claudio Cimminiello, Leonardo Bolognese

“…Antiplatelet therapy is the mainstay of treatment and secondary prevention of cardiovascular disease (CVD), including acute coronary syndrome (ACS), transient ischemic attack (TIA) or minor stroke, and peripheral artery disease (PAD). The P2Y12 inhibitors, of which clopidogrel was the first, play an integral role in antiplatelet therapy and therefore in the treatment and secondary prevention of CVD. …”
Get full text

Some Movement Mechanisms and Characteristics in Pebble Bed Reactor by Xingtuan Yang, Yu Li, Nan Gui, Xinlong Jia, Jiyuan Tu, Shengyao Jiang

“…However, this application is held back by the existence of mixing zone between central and peripheral regions, which results from pebbles’ dispersion motions. …”
Get full text

Spatial association network structure of agricultural carbon emission efficiency in Chinese cities and its driving factors by Xu Wei, Bohong Chen

“…Central cities generally exhibit higher efficiency levels, while the surrounding cities tend to have lower efficiency. (2) The carbon emission efficiency of city agriculture in China displays multidimensional, complex, and organic characteristics, with potential for enhanced network stability. (3) Agricultural regions in central and southeastern China dominate the spatial network, while regions with weaker agricultural sectors, like Beijing, Shanghai, and Ningxia, occupy peripheral positions. (4) Within the spatial association network of city agricultural carbon emission efficiency in China, Intra block spatial correlations are low, while interblock spatial correlations are strong, exhibiting significant spillover effects. (5)Variations in agricultural development levels and mechanization significantly enhance the formation of networks related to city agricultural carbon emission efficiency in China. …”
Get full text

Activation of Wnt/β-catenin in neural progenitor cells regulates blood–brain barrier development and promotes neuroinflammation by Dylan J. Sebo, Irshad Ali, Audrey R. Fetsko, Aubrey A. Trimbach, Michael R. Taylor

“…Additionally, we discovered a significant increase in the proliferation of microglia and infiltration of peripheral neutrophils indicative of a stereotypical neuroinflammatory response. …”
Get full text

Toward Fine-Grained Partitioning of Low-Level SRAM Caches for Emerging 3D-IC Designs by Sudipta Das, Bhawana Kumari, Siva Satyendra Sahoo, Yukai Chen, James Myers, Dragomir Milojevic, Dwaipayan Biswas, Julien Ryckaert

“…Our study focuses on partitioning and optimization of SRAM bit-cells and peripheral circuits, enabling heterogeneous integration, achieving up to 12% higher operating frequency with 50% leakage power reduction in the memory macros. …”
Get full text

The Effects of Nebulized Inhaled Triptolide on Airway Inflammation in a Mouse Model of Asthma by Yafang Miao, Li Wei, Hao Chen, Zeming Zhang, Li Han

“…Then bronchoalveolar lavage fluid (BALF), peripheral blood, and lung tissue were collected. Relevant cytokines, transcriptional factors, and CD4+Th17+ T cell proportions were assessed and compared. …”
Get full text

A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia by ZHANG Caihui, LIU Liying, ZHANG Zhenjie, WANG Wei, MA Mingsheng, SONG Hongmei

“…Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. …”
Get full text

Corneal Transplant Infection due to Alternaria alternata: A Case Report by Vasileios Konidaris, Andreana Mersinoglou, Timoleon-Achilleas Vyzantiadis, Domniki Papadopoulou, Kostas G. Boboridis, Panagiotis Ekonomidis

“…Three weeks after keratoplasty, epithelial edema and a stromal opacity with an infiltrate and development of peripheral corneal opacities appeared. The diagnosis of Alternaria alternata keratitis was made. …”
Get full text

Variations of the ulnar nerve within the ulnar tunnel and palm in a select South African population by Lutho Daza, Julia Fernandes, Geney Gunston, Jeshika Luckrajh-Williams

“…Background: Ulnar tunnel syndrome (UTS) is a rare peripheral neuropathy associated with the entrapment of the distal portion of the ulnar nerve (UN) in its course through the fibro-osseous ulnar tunnel (eponymously known as Guyon's canal) at the wrist. …”
Get full text

Vascular Inflammation and Endothelial Dysfunction in Experimental Hypertension by Carmine Savoia, Lidia Sada, Luigi Zezza, Lorenzo Pucci, Francesco Maria Lauri, Alberto Befani, Alessandro Alonzo, Massimo Volpe

“…Essential hypertension is characterized by increased peripheral vascular resistance to blood flow. The endothelium is a crucial regulator of vascular tone. …”
Get full text

Assessment of the Opinions of Anesthesiology and Reanimation Research Assistants Regarding Clinical Anatomy Education: A University Example by Mustafa Büyükcavlak, Zeliha Fazlıoğulları, Nadire Ünver Doğan, İnci Kara, Emine Aslanlar

“…Additionally, data such as age, gender, duration of clinical experience, experience with neuroaxial or peripheral nerve blocks, and participation in regional anesthesia courses were recorded. …”
Get full text

Differences in phenotypes of normal and malignant cells concerning chromosomal fragility and ganglioside expression by Iskra Sainova, Vera Kolyovska, Desislava Drenska, Dimitar Maslarov, Dimitrina Dimitrova-Dikanarova, Tzvetanka Markova

“…The spontaneous chromosomal fragility was tested by light microscopy observation of metaphases from peripheral blood lymphocytes of 8 patients with malignancies and of 8 healthy controls. …”
Get full text

Optimizing Acetabular Component Bone Ingrowth: The Wedge-Fit Bone Preparation Method by Dani M. Gaillard-Campbell, Thomas P. Gross

“…We hypothesize that these issues might be resolved by using a “wedge-fit method”, in which the component wedges into the peripheral acetabular bone rather than bottoming out and potentially toggling on the apex of the cup. …”
Get full text

Ameloblastic Fibro-Odontoma: A Diagnostic Challenge by Elen de Souza Tolentino, Bruna Stuchi Centurion, Marta Cunha Lima, Patrícia Freitas-Faria, Alberto Consolaro, Eduardo Sant'ana

“…Excisional biopsy was performed, and microscopic features showed strands and islands of odontogenic epithelium showing peripheral palisading and loosely arranged central cells, identical to stellate reticulum, embedded in a myxoid cell-rich stroma resembling the dental papilla. …”
Get full text

Experimental Results on Charge Fluctuations in Heavy-Ion Collisions by D. K. Mishra, P. Garg, P. K. Netrakanti, L. M. Pant, A. K. Mohanty

“…Measurements from the heavy-ion experiments at the SPS and RHIC energies observe that total charge fluctuations increase from central to peripheral collisions. The net-charge fluctuations in terms of dynamical fluctuation measure ν(+-,dyn) are studied as a function of collision energy (sNN) and centrality of the collisions. …”
Get full text

Generation and characterization of novel induced pluripotent stem cell (iPSC) lines derived from three symptomatic carriers of a pathogenic MYH11 variant and two non-carrier relati... by Aria Atash, Maarten Jan Cramer, Barend Mees, Pieter A. Doevendans, Joost P.G. Sluijter, Francesca Stillitano

“…Here, we report human induced pluripotent stem cell (iPSC) lines, generated from peripheral blood mononuclear cells (PBMCs) of three variant carriers and two non-carrying family members. …”
Get full text

Brain‐Derived Neurotrophic Factor (BDNF) as a Potential Biomarker in Brain Glioma: A Systematic Review and Meta‐Analysis by Fatemeh Hasani, Mahdi Masrour, Sina Khamaki, Kimia Jazi, Erfan Ghoodjani, Antonio L. Teixeira

“…ABSTRACT Background This systematic review and meta‐analysis evaluates peripheral and CNS BDNF levels in glioma patients. Methods Following PRISMA guidelines, we systematically searched databases for studies measuring BDNF in glioma patients and controls. …”
Get full text

头颈部外周原始神经外胚层肿瘤的影像学诊断

“…【目的】探讨头颈部外周型原始神经外胚层肿瘤（peripheral primitive neuroectrodermal tumor，pPNET）的影像学诊断特征。…”
Get full text