The APOA1 p.Leu202Arg variant potentially causes autosomal recessive cardiac amyloidosis by Shusuke Yagi, Ryosuke Miyamoto, Masayoshi Tasaki, Hiroyuki Morino, Ryuji Otani, Muneyuki Kadota, Takayuki Ise, Hiroki Yamazaki, Kenya Kusunose, Koji Yamaguchi, Hirotsugu Yamada, Takeshi Soeki, Tetsuzo Wakatsuki, Daiju Fukuda, Mitsuharu Ueda, Masataka Sata

“…Here, we report a 69-year-old man with sporadic cardiac amyloidosis who was born to consanguineous parents and carried a homozygous variant of p.Leu202Arg in APOA1.…”
Get full text

A pathogenic COL7A1 variant highlights semi-dominant inheritance in dystrophic epidermolysis bullosa by Saira Sattar, Thashi Bharadwaj, Umm-e- Kalsoom, Anushree Acharya, Saadullah Khan, Suzanne M. Leal, Isabelle Schrauwen

“…The inheritance pattern observed was consistent with a semi-dominant model, where heterozygous parents exhibited a mild phenotype, and homozygous children were more severely affected. For dystrophic epidermolysis bullosa, loss-of-function variants are typically associated with the autosomal recessive form, while missense variants are linked to the autosomal dominant form. …”
Get full text

Bone Mineral Density in Postmenopausal Women Heterozygous for the C282Y HFE Mutation by Jenny E. Gunton, Frances Gates, Greg R. Fulcher, Phillip B. Clifton-Bligh

“…Mutations in the HFE gene may be associated with increased tissue iron stores reflected in an elevated serum ferritin. With homozygous mutation C282Y, the increase in serum ferritin may be associated with tissue damage in the liver, pancreas, and pituitary and with a reduced bone mineral density. …”
Get full text

Bradykinin Type-2 Receptor Expression Correlates with Age and Is Subjected to Transcriptional Regulation by Inka Liesmaa, Naotaka Shiota, Jorma O. Kokkonen, Petri T. Kovanen, Ken A. Lindstedt

“…All analyzed CHD hearts were homozygous for the −9 allele. Thus, the expression of cardioprotective BK-2Rs in human hearts is increased with age in normal and IDC hearts and may be regulated on the transcriptional level. …”
Get full text

Characterisation of Drosophila UbxCPTI000601 and hthCPTI000378 Protein Trap Lines by Siew Woh Choo, Ching Yew Beh, Steven Russell, Robert White

“…No T3/A1 to T2 transformations were observed in the embryonic cuticle or the developing midgut. The homozygous survivors, however, exhibit a weak haltere phenotype with a few wing-like marginal bristles on the haltere capitellum. …”
Get full text

Truncated SPAG9 as a novel candidate gene for a new syndrome: Coarse facial features, albinism, cataract and developmental delay (CACD syndrome) by Majid Alfadhel, Bashayr S. Alhubayshi, Muhammad Umair, Ahmed Alfaidi, Deemah Alwadaani, Essra Aloyouni, Safdar Abbas, Abdulkareem Al Abdulrahman, Mohammed Aldrees, Abeer Al Tuwaijri, Ruaa S. Alharithy, Abdulaziz Alajlan, Abdulrahman Alswaid, Saad Almohrij, Sultan Al-Khenaizan

“…Whole genome sequencing (WGS) in families A and B revealed a homozygous frameshift variant (c.903del; p.Phe301Leufs*2) in the SPAG9 gene. …”
Get full text

A Case Report of Clinical Characteristics of Deficiency of Adenosine Deaminase 2 with Pancytopenia by ZHANG Caihui, LIU Liying, ZHANG Zhenjie, WANG Wei, MA Mingsheng, SONG Hongmei

“…Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. …”
Get full text

Marker-assisted identification of maize genotypes with improved protein quality by O. A. Orlovskaya, S. V. Kubrak, S. I. Vakula, L. V. Khotyleva, A. V. Kilchevsky

“…Amplification with three specific markers to the opaque-2 gene (phi057, phi112 and umc1066) revealed homozygous recessive o2 genotypes, associated with improved nutritional quality of the protein. …”
Get full text

Variability of PRDM9 in buffaloes by Luca Godoi Rocha Santana, Jackeline Santos Alves, Fabieli Loise Braga Feitosa, Victoria Camilla Parente Rocha, Humberto Tonhati, Raphael Bermal Costa, Gregório Miguel Ferreira de Camargo

“…The mating of different homozygous genotypes and genotypes carrying less frequent alleles may increase recombination rates and population variability. …”
Get full text

Association of endothelial nitric oxide synthase (NOS3) rs2070744 variant with advanced retinopathy of prematurity: a case–control study and meta-analysis by Aneta Choręziak-Michalak, Dawid Szpecht, Tomasz Woźniak, Anna Chmielarz-Czarnocińska, Patrycja Gazińska, Anna Gotz-Więckowska, Ewa Strauss

“…Meta-analysis including 298 patients and 397 controls confirmed this protective role. The rs2070744CC homozygous genotype exhibited an odds ratio (OR) of 0.42 (adjusted P = 0.036). …”
Get full text

Effect of some myostatin (MSTN) variants on live weight and beef traits measured by ultrasound in Charolais candidate breeding bulls by Ferenc Szabó, Gabriella Holló, Tamás Csürhés, Márton Török, Károly Tempfli, Edit Mikó, Szabolcs Bene

“…The F94L had a significant effect on the FRU and FRI, whereas REA significant differed between homozygous and heterozygous animals on SNP at nt267. …”
Get full text

Effect of genomic regions harboring putative lethal haplotypes on reproductive performance in closed experimental selection lines of Nellore cattle by Gustavo R. D. Rodrigues, Joslaine N. S. G. Cyrillo, Lúcio F. M. Mota, Patrícia I. Schmidt, Júlia P. S. Valente, Eduarda S. Oliveira, Lúcia G. Albuquerque, Luiz F. Brito, Maria E. Z. Mercadante

“…Abstract Lethal alleles are mutations in the genome that cause embryonic losses in affected homozygous embryos and, therefore, can negatively influence reproduction rates in commercial populations. …”
Get full text

Genetic assessment of apolipoprotein E polymorphism and PRNP genotypes in rapidly progressive dementias in Pakistan by Urwah Rasheed, Minahil Khalid, Aneeqa Noor, Umar Saeed, Rizwan Uppal, Saima Zafar

“…It is noteworthy that the MM homozygous genotype was present in 71 samples, VV genotype was present in 29. …”
Get full text

CSE-8, a filamentous fungus-specific Shr3-like chaperone, facilitates endoplasmic reticulum exit of chitin synthase CHS-3 (class I) in Neurospora crassa by Samantha Verónica González-Téllez, Meritxell Riquelme

“…Additionally, sexual development was disrupted in the Δcse-8 strain, with 20% of perithecia from homozygous crosses exhibiting two ostioles. A Δcse-7;Δcse-8 double mutant strain showed reduced N-acetylglucosamine (GlcNAc) content and decreased radial growth. …”
Get full text

Comparative gametogenesis and genomic signatures associated with pollen sterility in the seedless mutant of grapevine by Siddhi Chavan, Satish Phalake, Sujata Tetali, Vitthal T. Barvkar, Ravindra Patil

“…Genome sequence data was also used to identify induced mutations in the seedless mutant, which revealed three homozygous and 25 heterozygous InDels in the genes related to male gametophyte development. …”
Get full text

High frequency CCR5 editing in human hematopoietic stem progenitor cells protects xenograft mice from HIV infection by Daniel T. Claiborne, Zachary Detwiler, Steffen S. Docken, Todd D. Borland, Deborah Cromer, Amanda Simkhovich, Youdiil Ophinni, Ken Okawa, Timothy Bateson, Tao Chen, Wesley Hudson, Radiana Trifonova, Miles P. Davenport, Tony W. Ho, Christian L. Boutwell, Todd M. Allen

“…Abstract The only cure of HIV has been achieved in a small number of people who received a hematopoietic stem cell transplant (HSCT) comprising allogeneic cells carrying a rare, naturally occurring, homozygous deletion in the CCR5 gene. The rarity of the mutation and the significant morbidity and mortality of such allogeneic transplants precludes widespread adoption of this HIV cure. …”
Get full text

IP3 receptor depletion in a spontaneous canine model of Charcot-Marie-Tooth disease 1J with amelogenesis imperfecta. by Marjo K Hytönen, Julius Rönkkö, Sruthi Hundi, Tarja S Jokinen, Emilia Suonto, Eeva Teräväinen, Jonas Donner, Rita La Rovere, Geert Bultynck, Emil Ylikallio, Henna Tyynismaa, Hannes Lohi

“…Here, we report the identification of a homozygous nonsense variant in the ITPR3 gene in Lancashire Heeler dogs, presenting with a severe developmental enamel defect and reduced nerve conduction velocity. …”
Get full text

Positive and negative regulation of Gli activity by Kif7 in the zebrafish embryo. by Ashish Kumar Maurya, Jin Ben, Zhonghua Zhao, Raymond Teck Ho Lee, Weixin Niah, Ashley Shu Mei Ng, Audrey Iyu, Weimiao Yu, Stone Elworthy, Fredericus J M van Eeden, Philip William Ingham

“…Remarkably, zebrafish lacking all Kif7 function are viable, in contrast to the peri-natal lethality of mouse kif7 mutants but similar to some Acrocallosal or Joubert syndrome patients who are homozygous for loss of function KIF7 alleles.…”
Get full text

Distribution of the arctic variant of the CPT1A gene in indigenous populations of Siberia by B. A. Malyarchuk, M. V. Derenko, G. A. Denisova, A. N. Litvinov

“…It is also known that the homozygous Arctic variant is associated with hypoketotic hypoglycemia attributable to CPT1A deficiency and high infant mortality and occurs at high frequency in American Eskimo. …”
Get full text

Altered Forebrain Functional Connectivity and Neurotransmission in a Kinase-Inactive Mouse Model of Autism by Shiyu Tang PhD, Elizabeth M. Powell PhD, Wenjun Zhu MS, Fu-Sun Lo MD, Reha S. Erzurumlu PhD, Su Xu PhD

“…We employed resting-state functional magnetic resonance imaging and in vivo high-resolution proton MR spectroscopy to examine neuronal connectivity and neurotransmission of wild-type, heterozygous Met–Emx1 , and fully inactive homozygous Met–Emx1 mice. Met–Emx1 brains showed impaired maturation of large-scale somatosensory network connectivity when compared with wild-type controls. …”
Get full text