Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq
The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two fami...
Saved in:
| Main Authors: | , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
University of Basrah
2024-12-01
|
| Series: | Maǧallaẗ al-baṣraẗ al-ʻulūm al-zirāʻiyyaẗ |
| Subjects: | |
| Online Access: | https://www.bjas.bajas.edu.iq/index.php/bjas/article/view/1999 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| _version_ | 1841560722946916352 |
|---|---|
| author | Berivan A. Latef Luay A. Ali |
| author_facet | Berivan A. Latef Luay A. Ali |
| author_sort | Berivan A. Latef |
| collection | DOAJ |
| description | The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results.
|
| format | Article |
| id | doaj-art-b1483c7ee0714d90885b09bfbb2add7b |
| institution | Kabale University |
| issn | 1814-5868 2520-0860 |
| language | English |
| publishDate | 2024-12-01 |
| publisher | University of Basrah |
| record_format | Article |
| series | Maǧallaẗ al-baṣraẗ al-ʻulūm al-zirāʻiyyaẗ |
| spelling | doaj-art-b1483c7ee0714d90885b09bfbb2add7b2025-01-03T18:58:05ZengUniversity of BasrahMaǧallaẗ al-baṣraẗ al-ʻulūm al-zirāʻiyyaẗ1814-58682520-08602024-12-01372Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, IraqBerivan A. Latef0Luay A. Ali1Department of Biology, College of Education, University of Salahaddin, IraqDepartment of Biology, College of Education, University of Salahaddin, IraqThe current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results. https://www.bjas.bajas.edu.iq/index.php/bjas/article/view/1999Molecular studyMorphology identificationsOstracodPCRPhylogenetic analysis |
| spellingShingle | Berivan A. Latef Luay A. Ali Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq Maǧallaẗ al-baṣraẗ al-ʻulūm al-zirāʻiyyaẗ Molecular study Morphology identifications Ostracod PCR Phylogenetic analysis |
| title | Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq |
| title_full | Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq |
| title_fullStr | Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq |
| title_full_unstemmed | Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq |
| title_short | Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq |
| title_sort | morphological and molecular study of seven new recorded of ostracod in kurdistan region iraq |
| topic | Molecular study Morphology identifications Ostracod PCR Phylogenetic analysis |
| url | https://www.bjas.bajas.edu.iq/index.php/bjas/article/view/1999 |
| work_keys_str_mv | AT berivanalatef morphologicalandmolecularstudyofsevennewrecordedofostracodinkurdistanregioniraq AT luayaali morphologicalandmolecularstudyofsevennewrecordedofostracodinkurdistanregioniraq |